Tender Information - 9311334141 | Support - 011-41314141 | Tender Bidding - 9311334141
Advance Search
Product List » prime tenders

Prime Tenders

Latest Prime Government Tenders, 20 live tenders are available from Government, Public and private sector, online e-tender / e-Procurement list from various Government Department of . Tenders list from Corporations, PSU and Private Companies are also available. A list of private tenders / enquires are also available from for supply of various services and products..

  1. mon, nagaland
surf wk incl gsb, wmm, bc, dbm incl prime coat, tack coat, rd marking and earthen shoulder bet km 10.000 to km 12.100 and km 13.900 to km 16.800 on road mon-tang under 100 rcc/15 brtf under project se
04 May 2026 6.34 Crore FtId : 26032545930
33 Days is Left
Buy This
  1. ghaziabad, uttar pradesh
supply of red oxide/ metal primer
21 Apr 2026 Refer Document FtId : 26033144280
20 Days is Left
Buy This
  1. ghaziabad, uttar pradesh
supply of red oxide metal primer
20 Apr 2026 Refer Document FtId : 26033144520
19 Days is Left
Buy This
  1. shriwardhan, maharashtra
procurement of prime mover
20 Apr 2026 Refer Document FtId : 26033047890
19 Days is Left
Buy This
  1. jammu, jammu & kashmir
supply of clove oil inc flavour evening prime rose oil lycopene flax oil
15 Apr 2026 Refer Document FtId : 2603264220
14 Days is Left
Buy This
  1. port blair, andaman & nicobar
paint epoxy aluminium primer ( anti corr epoxy resinbase)
14 Apr 2026 Refer Document FtId : 26032541250
13 Days is Left
Buy This
Gem Registration Support
  1. port blair, andaman & nicobar
supply of primer above water exterior for aluminium substrate
14 Apr 2026 Refer Document FtId : 26032541420
13 Days is Left
Buy This
  1. port blair, andaman & nicobar
supply of epoxy based primer for application in ballast tank
14 Apr 2026 Refer Document FtId : 26032541560
13 Days is Left
Buy This
  1. aizawl, mizoram
completion of incomplete/ bal works for pdg and lyg of wmm 75 mm, 100 mm inclg prime coat using bit emulsion, dbm 50 mm, bc 30 mm inclg cleaning, applying tack coat with bitmen vg-10 bet km 20 to km 3
10 Apr 2026 7.35 Crore FtId : 260228434130
9 Days is Left
Buy This
  1. port blair, andaman & nicobar
ekterior synthetic brushing spray white, varnishblack japan, paint priming coal tar epoxy brown brushing, paint priming coal tar epoxy black brushing, paint epoxy aluminium primer anti corr epoky resi
09 Apr 2026 Refer Document FtId : 26032047290
8 Days is Left
Buy This
  1. seoni, madhya pradesh
under the prime minister`s housing scheme, construction of a ss road from the village main road to 116 houses (approach road) in village binjhwara (kandipar).
08 Apr 2026 18.89 Lac FtId : 26030945700
7 Days is Left
Buy This
  1. namsang, arunachal pradesh
supply of anti corrosive red oxide zinc chromate primer
06 Apr 2026 Refer Document FtId : 26032647650
5 Days is Left
Buy This
  1. namsang, arunachal pradesh
supply of anti corrosive red oxide zinc chromate primer confirming to is 5 2004 make berger and asian and nerolac
06 Apr 2026 Refer Document FtId : 26032647880
5 Days is Left
Buy This
  1. namsang, arunachal pradesh
supply of anti corrosive red oxide zinc chromate primer confirming to is 5 2004 make berger and asian and nerolac
06 Apr 2026 Refer Document FtId : 26032648380
5 Days is Left
Buy This
  1. namsang, arunachal pradesh
supply of anti corrosive red oxide zinc chromate primer confirming to is 5 2004 make berger and asian and nerolac
06 Apr 2026 Refer Document FtId : 26032648830
5 Days is Left
Buy This
  1. siliguri, west bengal
supply of red oxide primer
03 Apr 2026 Refer Document FtId : 26032147290
2 Days is Left
Buy This
  1. namsang, arunachal pradesh
supply of anti corrosive red oxide zinc chromate primer conforming to is 5 2004 make asian and berger and neroloc
03 Apr 2026 Refer Document FtId : 26032442030
2 Days is Left
Buy This
  1. namsang, arunachal pradesh
supply of anti corrosive red oxide zinc chromate primer conforming to is 5 2004 make asian and berger and neroloc
03 Apr 2026 Refer Document FtId : 26032442420
2 Days is Left
Buy This
  1. namsang, arunachal pradesh
supply of anti corrosive red oxide zinc chromate primer conforming to is-5-2004 make asian and berger and neroloc
03 Apr 2026 Refer Document FtId : 26032442760
2 Days is Left
Buy This
  1. delhi
supply of forward agtggttctgcttcttagcg 20bp 1 primers
01 Apr 2026 Refer Document FtId : 260312499610
0 Days is Left
Buy This
Subscribe/Upgrade Membership
Buy Digital Certificate
Tender Alert Service
Tender Bidding Consultancy
Gem Registration Service
MSME / Udyam Registration
ISO Registration
Digital Signature (DSC)
Tender Training Program
Gem Training Program
Vendor Registration